(E) InDel quantification at gRNA target site in edited HSPCs. HBA2 copies (C) and KI efficiency (D) in edited HSPCs in erythroid liquid culture (●) or in BFU-E (■). HSPCs from 1 patient of each genotype were used. A comprehensive report is provided. In addition, by transplanting HSPCs in humanized NSG, we demonstrated that both HBA2 deletion and βAS3 KI occur in long-term HSCs and that edited HSCs can give rise to multiple progenitors and differentiated hematopoietic lineages. We used MoFlocell sorter (Beckman Coulter) to select live GFP+ cells. Black lines represent mean. Other names that describe the test. We confirmed that this “double” editing is feasible and efficient in primary human HSPCs from healthy donors and β+- or β0-thalassemia patients and does not affect erythroblast differentiation. Digital droplet PCR (ddPCR) was performed according to manufacturer’s instruction using ddPCR Supermix for Probes No dUTP (BioRad, Hercules, CA) and 1 to 50 ng of genomic DNA digested with HindIII (New England Biolabs, Ipswich, MA). Colony-forming unit-granulocyte, erythroid, macrophage, megakaryocyte; Bars represent mean ± SD (n = 2-4). Black lines represent mean. The lower number of DSBs could also explain the reduced toxicity observed in CFC edited with Cas9 D10A (Figure 6F-G). When using RNP D10A, we observed that, without inducing any InDels (supplemental Figure 5E), both single and dual gRNA induced efficient HBA2 deletion and HDR integration, although to a lower extent compared with RNP (supplemental Figure 5F-H). Pre-Authorization List for EmblemHealth Members: This is a complete list of all services requiring a Prior Approval for EmblemHealth members subject to their benefit plan's coverage for all places of service, including Office (POS 11). In our laboratory, range of HbA2 value with normal RBC parameter was 2.0â3.3%. Further analysis revealed a high proportion of erythroid lineage cells in the bone marrow mononuclear cells (35.8%), characterized by up-regulation of hemoglobin-related genes (e.g., HBA2 and HBB). Recommendations when to order or not order the test. Upon identification of the genomic regions integrating double-stranded oligonucleotides in aligned data, off-target sites were identified if, at most, 7 mismatches against the target were present and if absent in the background controls. conceived the study, designed and performed experiments, analyzed data, and wrote the manuscript; A.F. was supported by European Union’s Horizon 2020 (SCIDNET No 666908). Technically, we deliver Cas9/gRNA as RNP, which allows efficient HSPC modification without any selection and is already used in clinical trials (eg, NCT03164135, NCT03655678). This test was developed and its performance characteristics determined by ARUP Laboratories. (C) Relative abundance of endogenous β and KI-βAS3 mRNA at day 12 of erythroid liquid culture (mean ± SD, n = 3-4). Targeted integration of a βAS3transgene in the α-globin locus corrects thalassemic phenotype in HUDEP-2 β0cells. All reagents and detailed sequence information are available upon request. Bars represent mean ± SD (n = 3-4); red dashed line indicates 100%. (D) Reverse transcription-qPCR quantification of α/β-like globin mRNA ratios in HUDEP-2 β0 (n = 3-5) and in single-cell clones with monoallelic (α-/αα; n = 3) or biallelic (α-/α-; n = 3) HBA2 deletions. We then plated HSPCs in methylcellulose containing cytokines supporting erythroid and myeloid differentiation (CFC assay), and we confirm that modified progenitors retained their multilineage potential, although some toxicity was observed (supplemental Figure 2D-E). Reduced amounts of detectable beta globin causes beta-plus-thalassemia. HBA2 deletion and βAS3integration efficiency in HSPCs. Abnormal hemoglobin variants may require additional testing, which increases TAT up to 21 days. Importantly, our HBA2 deletion strategy reduced but did not abolish α-globin production, as observed in α-globin KO control cells obtained with a gRNA targeting the coding sequence within the first exon of HBA1 and HBA2 genes (Figure 1D). Representative chromatograms (E) and relative quantification (F) of β-like subunits are shown; (mean ± SD; n = 3). A negative result reduces, but does not eliminate, the likelihood of the donor being a carrier. C-reactive protein: 1.2 mg/L (normal range 1.0-3.0 mg/L) WBC count: 8,400/mm3 Based on the patient's symptoms and abnormal laboratory results, the physician ⦠This ⦠Hemoglobin A (Hb A), composed of both alpha and beta globin, is the type of hemoglobin that normally makes up 95% to 98% of hemoglobin in adults. Please follow the EQAS Online setup procedure on QCNet before accessing the mobile application. Editing was measured across HBA2 deletion junctions. RNA was reverse-transcribed using Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). HSPC-derived erythroblasts were lysed in water and globin chains were separated using a 250 × 4.6-mm, 3.6-µm Aeris Widepore column (Phenomenex, Torrance, CA). HSPCs derived from 1 patient of each genotype were used for this figure. γ4, Hb Bart; acHbF, acetylated fetal hemoglobin; HbF, fetal hemoglobin (α2γ2); α-p, α-precipitates; HbA, adult hemoglobin (α2β2). Human cell engraftment and knockin (KI) levels were monitored at different time points in peripheral blood by flow cytometry using anti-human CD45 and HLA-ABC antibodies (supplemental Table 1). Values are expressed as mean ± standard deviation (SD) as otherwise indicated, with "n" indicating the number of independent biological replicates used in each group. © 2021 ARUP Laboratories. It is difficult to determine whether they are carriers of silent mutations or high normal HbA2 without genetic test. Deletion of HBA2 reduces α-globin precipitates in HUDEP-2 β0cells. GUIDE-seq datasets are available in the BioProject online repository (ID PRJNA676022; http://www.ncbi.nlm.nih.gov/bioproject/676022). BM, bone marrow; PB, peripheral blood; SP, spleen. Search for other works by this author on: The challenge of haemoglobinopathies in resource-poor countries, α-Globin as a molecular target in the treatment of β-thalassemia, Effect of alpha-gene numbers on phenotype of HbE/beta thalassemia patients, Coinheritance of the different copy numbers of alpha-globin gene modifies severity of beta-thalassemia/Hb E disease, The correlation of α-globin gene mutations and the XmnI polymorphism with clinical severity of Hb E/β-thalassemia, Management of iron overload in hemoglobinopathies, On modeling human leukocyte antigen-identical sibling match probability for allogeneic hematopoietic cell transplantation: estimating the need for an unrelated donor source, Gene therapy for hemoglobinopathies: the state of the field and the future, Outcomes after matched unrelated donor versus identical sibling hematopoietic cell transplantation in adults with acute myelogenous leukemia, Therapeutic options for patients with severe beta-thalassemia: the need for globin gene therapy, Intrabone hematopoietic stem cell gene therapy for adult and pediatric patients affected by transfusion-dependent ß-thalassemia, Gene therapy in patients with transfusion-dependent β-thalassemia, Highly efficient therapeutic gene editing of human hematopoietic stem cells, Natural regulatory mutations elevate the fetal globin gene via disruption of BCL11A or ZBTB7A binding, Induction of fetal hemoglobin synthesis by CRISPR/Cas9-mediated editing of the human β-globin locus, A genome-editing strategy to treat β-hemoglobinopathies that recapitulates a mutation associated with a benign genetic condition, Restoration of the balanced alpha/beta-globin gene expression in beta654-thalassemia mice using combined RNAi and antisense RNA approach, Editing an α-globin enhancer in primary human hematopoietic stem cells as a treatment for β-thalassemia, A recombinant human hemoglobin with anti-sickling properties greater than fetal hemoglobin, An optimized lentiviral vector efficiently corrects the human sickle cell disease phenotype, Production, purification and characterization of adeno-associated vectors, Fast and reliable titration of recombinant adeno-associated virus type-2 using quantitative real-time PCR, Optimization of CRISPR/Cas9 delivery to human hematopoietic stem and progenitor cells for therapeutic genomic rearrangements, Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells, Growing and genetically manipulating human umbilical cord blood-derived erythroid progenitor (HUDEP) cell lines, Homology-directed repair in rodent zygotes using Cas9 and TALEN engineered proteins, Plerixafor and G-CSF combination mobilizes hematopoietic stem and progenitors cells with a distinct transcriptional profile and a reduced, Cellular function reinstitution of offspring red blood cells cloned from the sickle cell disease patient blood post CRISPR genome editing, Easy quantitative assessment of genome editing by sequence trace decomposition, GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases, Open-source guideseq software for analysis of GUIDE-seq data, CRISPResso2 provides accurate and rapid genome editing sequence analysis, Variants in genetic modifiers of β-thalassemia can help to predict the major or intermedia type of the disease, Molecular basis and genetic modifiers of thalassemia, Ex vivo editing of human hematopoietic stem cells for erythroid expression of therapeutic proteins [published correction appears in, Comparative analysis of FV vectors with human α- or β-globin gene regulatory elements for the correction of β-thalassemia, High-level erythroid-specific gene expression in primary human and murine hematopoietic cells with self-inactivating lentiviral vectors, The new self-inactivating lentiviral vector for thalassemia gene therapy combining two HPFH activating elements corrects human thalassemic hematopoietic stem cells, Role of the hepatitis B virus posttranscriptional regulatory element in export of intronless transcripts, Homology-driven genome editing in hematopoietic stem and progenitor cells using ZFN mRNA and AAV6 donors, Development of functional human blood and immune systems in NOD/SCID/IL2 receptor gamma chain(null) mice, Macrophages prevent human red blood cell reconstitution in immunodeficient mice, Editing the sickle cell disease mutation in human hematopoietic stem cells: comparison of endonucleases and homologous donor templates, Precise gene editing preserves hematopoietic stem cell function following transient p53-mediated DNA damage response, Targeted genome editing in human repopulating haematopoietic stem cells, In vivo selection of genetically modified erythroblastic progenitors leads to long-term correction of beta-thalassemia, Single-strand break repair and genetic disease, Multiplex genome engineering using CRISPR/Cas systems, Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity [published correction appears in, In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting, Single-strand nicks induce homologous recombination with less toxicity than double-strand breaks using an AAV vector template, The differences in quantities of alpha 2- and alpha 1-globin gene variants in heterozygotes, Hydroxyurea can eliminate transfusion requirements in children with severe beta-thalassemia, Alpha globin gene mutation: a major determinant of hydroxyurea response in transfusion-dependent HbE-β-thalassaemia, The emerging role of fetal hemoglobin induction in non-transfusion-dependent thalassemia, Correction of β654-thalassaemia mice using direct intravenous injection of siRNA and antisense RNA vectors, siRNA-mediated reduction of alpha-globin results in phenotypic improvements in beta-thalassemic cells, A double-switch vector system positively regulates transgene expression by endogenous microRNA expression (miR-ON vector), Lethal toxicity caused by expression of shRNA in the mouse striatum: implications for therapeutic design, Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways, Lentiviral delivery of short hairpin RNAs, Biosafety challenges for use of lentiviral vectors in gene therapy, Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia, Identification of two new synthetic histone deacetylase inhibitors that modulate globin gene expression in erythroid cells from healthy donors and patients with thalassemia, Selective silencing of α-globin by the histone demethylase inhibitor IOX1: a potentially new pathway for treatment of β-thalassemia, Synergistic silencing of α-globin and induction of γ-globin by histone deacetylase inhibitor, vorinostat as a potential therapy for β-thalassaemia, CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations, Expanding the editable genome and CRISPR-Cas9 versatility using DNA cutting-free gene targeting based on in trans paired nicking, Tandem paired nicking promotes precise genome editing with scarce interference by p53, Polymer-stabilized Cas9 nanoparticles and modified repair templates increase genome editing efficiency, Gene correction for SCID-X1 in long-term hematopoietic stem cells [published corrections appear in, Development of hRad51-Cas9 nickase fusions that mediate HDR without double-stranded breaks, PARP-mediated repair, homologous recombination, and back-up non-homologous end joining-like repair of single-strand nicks, Nick-initiated homologous recombination: protecting the genome, one strand at a time, Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9, Genome editing of HBG1 and HBG2 to induce fetal hemoglobin, Reactivation of γ-globin in adult β-YAC mice after ex vivo and in vivo hematopoietic stem cell genome editing, Comparative genome analysis delimits a chromosomal domain and identifies key regulatory elements in the alpha globin cluster, Repair of double-strand breaks induced by CRISPR-Cas9 leads to large deletions and complex rearrangements [published correction appears in, Allele-specific chromosome removal after Cas9 cleavage in human embryos, Long-term evaluation of AAV-CRISPR genome editing for Duchenne muscular dystrophy, High levels of AAV vector integration into CRISPR-induced DNA breaks, Deep profiling reveals substantial heterogeneity of integration outcomes in CRISPR knock-in experiments, CRISPR/Cas9-mediated targeted chromosome elimination, Introducing a spectrum of long-range genomic deletions in human embryonic stem cells using type I CRISPR-Cas, Long-read individual-molecule sequencing reveals CRISPR-induced genetic heterogeneity in human ESCs, Next-generation mapping: a novel approach for detection of pathogenic structural variants with a potential utility in clinical diagnosis, Partner independent fusion gene detection by multiplexed CRISPR-Cas9 enrichment and long read nanopore sequencing, The co-inheritance of alpha-thalassemia and sickle cell anemia is associated with better hematological indices and lower consultations rate in Cameroonian patients and could improve their survival, The interaction of alpha-thalassemia and homozygous sickle-cell disease, NHLBI Trans-Omics for Precision Medicine (TOPMed) Consortium, Hematology & Hemostasis, Diabetes, and Structural Variation TOPMed Working Groups, Common α-globin variants modify hematologic and other clinical phenotypes in sickle cell trait and disease, Variability of homozygous sickle cell disease: the role of alpha and beta globin chain variation and other factors, Correction of a mouse model of sickle cell disease: lentiviral/antisickling beta-globin gene transduction of unmobilized, purified hematopoietic stem cells, © 2021 by The American Society of Hematology, Copyright ©2020 by American Society of Hematology, https://doi.org/10.1182/bloodadvances.2020001996, http://www.ncbi.nlm.nih.gov/bioproject/676022. Lines represent mean. Biochemistry Written by Satyanarayan Send by Mangha Deewan Pharmacist , 2019. Conflict-of-interest disclosure: G.P. A total of 200 ng of genomic DNA of RNP-edited HSPCs were used to amplify top 3 off-targets identified with Guide-Seq using Phusion High-Fidelity polymerase (New England Biolabs). Ambient: Unacceptable; Refrigerated: 1 week; Frozen: Unacceptable. PCR amplification was then performed using 1 ng of double-stranded ligation product and Kapa Taq polymerase reagents (KAPA HiFi HotStart ReadyMix PCR Kit; Sigma-Aldrich). Depending on findings, one or more reflexive tests may be required in order to provide a clinical interpretation. In some experiments, BFU-E were picked and cultured in erythroid progenitor expansion medium, as previously described.30. Black lines indicate mean; gray line shows the range of α/β-like globin ratio in healthy donor MPB and UCB HSPCs (n = 5). If an abnormal hemoglobin is detected or if the CBC data is suggestive of a hemoglobinopathy, appropriate testing will be performed at an additional charge. Additional experiments will be performed to systematically compare these 2 gene therapy strategies; however, our encouraging results support the development of a CRISPR/Cas9-based gene therapy approach. Cells were fixed and/or permeabilized using Cytofix/Cytoperm (BD Bioscience, San Jose, CA) according to the manufacturer's instructions. Both edited HSPCs showed successful engraftment in bone marrow, spleen and blood, and multilineage differentiation (Figure 4B; supplemental Figure 3B). Illumina-compatible barcoded DNA amplicon libraries were prepared using TruSeq DNA PCR-Free Kit (Illumina). This test was performed in a CLIA certified laboratory and is intended for clinical purposes. Indicates test has been approved by the New York State Department of Health. β-Thalassemia heterozygotes (minor) have mild anemia microcytic, hypochromic erythrocytes with increased HbA2 (<5-7%) and normal or mildly increased HbF (less than 5%) with the rest being HbA. 1/20/2020. Are you an ARUP Client? 9/19/2019. To compare the efficiency of HBA2 deletion and transgene targeted integration with single vs trans paired nicking of genomic DNA,52 we selected another gRNA targeting α-globin 5′UTR (HBA20; supplemental Figure 5A-C) to combine with gRNA HBA15. By sequencing the tumor and e.g. Clinical data show that severity of β-thal correlates with the number of inherited α-globin genes (HBA1 and HBA2), with α-globin gene deletions having a beneficial effect for patients. Red cell distribution width (RDW) is often normal ; Pre-pregnancy carrier testing of partner is important (Ensure parents have been tested if likely to have more children) Note: HbA2 may not be elevated in the presence of concomitant iron deficiency, therefore give iron treatment (if ferritin low) before ordering test. We designed 2 different cassettes for the expression of HBB (gene ID: 3043): (1) the first cassette contains a β-globin complementary DNA (cDNA), with 3 antisickling point mutations (βAS3),21 followed by a woodchuck posttranscriptional regulatory element and a SV40polyA; and (2) the second cassette contains the whole βAS3 gene with introns and its original 3′ untranslated region (UTR) and polyA (pA) site, with 3 antisickling point mutations. K562 cells (ATCC CCL243) were maintained in RPMI 1640 medium containing 2 mM glutamine and supplemented with 10% fetal bovine serum (Lonza, Basel, Switzerland), 10 mM N-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid, 1 mM sodium pyruvate, and penicillin and streptomycin (100 U/mL each; Gibco, Waltham, MA).25, HUDEP-2 β0 cells were derived from a HUDEP-226 clone where both β-globin alleles were knocked out using CRISPR/Cas9 and a guide RNA (gRNA) targeting HBB exon 1 (HBB gRNA), as previously described.17 Both HUDEP-2 and HUDEP-2 β0 cells erythroid differentiation was performed in presence of doxycycline in 2 phases, with and without stem cell factor to promote erythroid maturation.27. Percentages are indicated. All Rights Reserved. Upon differentiation, HSPC-derived erythroblasts expressed βAS3-mRNA, which accounted for ∼15% (14.2 ± 9.4, n = 6) of total β globin RNA (Figure 3E-F). If reflexed additional CPT codes may apply; refer to the reflexed test code for applicable codes. Because HBA1 and HBA2 are similarly expressed, 54 removal of 1 or 2 HBA2 genes should reduce α-globin expression to â¼75% to 50% of its normal level, thus falling in the therapeutic window to benefit β-thal. In the absence of β-globin, a portion of the α-globin pool complexes with β-like globins, such as γ- and δ-globins (to form HbF and HbA2, respectively), whereas the excess precipitates in insoluble aggregates (α-precipitates). Inspired by clinical data showing that α-thalassemia ameliorates β-thalassemia,3 several groups have proposed artificial downregulation of α-globin expression as potential treatment of β+-thalassemia, where residual β-globin expression guarantees sufficient hemoglobin formation (such as HbE, about one-half of all β-thalassemias).3. MPB- or UCB-derived HSPCs were thawed and cultured in prestimulation media for 48 hours (StemSpan, Stemregenin-1 0.75 μM, UM171 0.35 μM; StemCell Technologies, Vancouver, BC, Canada; rhSCF 300 ng/mL, rhFlt3-L 300 ng/mL, rhTPO 100 ng/mL, and rhIL-3 20 ng/mL; CellGenix, Freiburg, Germany). laboratory, Marina Cavazzana, Anne Galy, and Ronzitti for fruitful discussion. (F) CFC number expressed as percentage of untreated control (UT). Glycated hemoglobin (glycohemoglobin, HbA1c, hemoglobin A1c, A1c, or less commonly HbA 1c, HgbA1c, Hb1c, etc.) It has not been cleared or approved by the US Food and Drug Administration. Absence of beta chain causes beta-zero-thalassemia. Fifty nanograms of genomic DNA were used to amplify the region that spans the cutting site of each gRNA using KAPA2G Fast ReadyMix (Kapa Biosystem, Wilmington, MA). This work was supported by grants from Bayer Hemophilia Awards Program (G.P.) gRNA nucleotide sequence is indicated on top (in bold/underlined the protospacer adjacent motif sequence). (F) α/β-like globin mRNA ratios in edited thalassemic BFU-E. β0/β+colonies (n = 71) are plotted on the left axis, β0/β0 (n = 63) on the right axis. Genomic DNA was sheared using a Covaris S200 sonicator to an average length of 500 bp and subsequently end-repaired. This test assess the type and relative amounts of hemoglobin present in red blood cells. The expression of each target gene was normalized using human GAPDH as a reference gene (NM_002046.6) and represented as 2ΔCt for each sample or as fold changes (2ΔΔCt) relative to the control. CD34+ cells were selected from patients affected by β-thalassemia as described29 upon signed informed consent approved by the Ethical Committee of the San Raffaele Hospital (Milan, Italy). The same gRNA that deletes the HBA2 gene will facilitate the integration of the β-globin transgene at this locus, whereas the endogenous HBA promoter will provide strong erythroid β expression, as previously suggested.38-40 To discriminate exogenous vs endogenous β-globin expression, we used an HBB transgene containing 3 antisickling point mutations (βAS3).21. The LV encoding the βAS3 gene under the control of the erythroid specific β-globin enhancer/promoter was already described.22. The codes reflect our interpretation of CPT coding requirements based upon AMA guidelines published annually. We quantified HBA2 deletions, but we could not detect any HBA2 inversion by PCR analysis of edited HSPCs, although inversions are reported to be a frequent side product when generating CRISPR genomic deletions.17,78 This observation could be a true negative result, as previously reported for HBG editing in HSPCs,79,80 or because of technical difficulties associated with amplification of repetitive inverted sequences with high GC content present in the α-globin locus.81 In addition, on-target cleavage can generate undesired chromosomal alterations,70,82-84 whereas integration of AAV donor DNA can occur via HDR as well as via partial HDR or nonhomologous end joining with or without the HBA2 deletion.85-87 A combination of whole genome sequencing,88 long-range PCR,89 long-read sequencing,90 next-generation mapping,91 and/or directional sequencing92 will help to address these concerns by unraveling the full spectrum of editing outcomes. Percentages are indicated (n = 58). Normal MCV (76-96 fl) with low Hb is typical of pregnancy. See supplemental Table 2 for primer sequences. Top: βAS3 cDNA followed by the woodchuck posttranscriptionally regulatory element (WPRE) and SV40 pA (βAS3 cDNA); bottom: βAS3 transgene that includes endogenous introns, 3′UTR and pA (βAS3 full). Reads with a mapping quality lower than 50 were filtered out. Genomic DNA extraction was performed using DNeasy Blood and Tissue Kit (Qiagen) following manufacturer’s instructions. The sequencing reaction was performed with MiSeq sequencing system (Illumina) using an Illumina Miseq Reagent Kit V2 - 300 cycles (2 × 150 bp paired-end) and raw sequencing data (FASTQ files) were analyzed using the GUIDE-Seq computational pipeline.33 Briefly, after demultiplexing, putative PCR duplicates were consolidated into single reads and mapped to the human reference genome GrCh37. This condition is caused by changes to the genes for haemoglobin. All recombinant single-stranded AAV2/6 used in this study were produced using a triple transfection protocol and purified by 2 sequential cesium chloride density gradients or chromatography, as described earlier.23 The vector titer of each preparation was determined by real-time quantitative polymerase chain reaction (qPCR)–based titration method using primers and probe corresponding to the inverted terminal repeat region of the AAV genome.24. Chemically modified single guide RNA were purchased from Synthego (with protospacer adjacent motif): 5′ UTR (HBA15) gRNA: GGGUUCUCUCUGAGUCUGUG(GGG), HBA knockout (KO) gRNA: GUCGGCAGGAGACAGCACCA(TGG), HBA20 gRNA: CATAAACCCTGGCGCGCTCG(CGG). (E) βAS3 and glycophorin A (GYPA) transcripts in HSPC-derived erythroblasts (qPCR, n = 2, mean ± SD). Using CRISPR/Cas9, we combined 2 therapeutic approaches: (1) α-globin downregulation, by deleting the HBA2 gene to recreate an α-thalassemia trait, and (2) β-globin expression, by targeted integration of a β-globin transgene downstream the HBA2 promoter. Primers and probe were optimized using the standard curve method to reach 100% ± 5% efficiency. performed experiments and analyzed data on HUDEP-2 β0 cells; F.A. Contribution: G.P. (I) Genotypes distribution of single KI-βAS3 BFU-E. Correspondence: Mario Amendola, INTEGRARE, Genethon, UMR S951 INSERM, University Evry, University Paris-Saclay, 1 bis, Rue de I’Internationale, 91000 Evry, France; e-mail: mamendola@genethon.fr.
Körper Vibriert Wechseljahre, Icloud Notizen Windows, Wasser Erde Minecraft, Relationale Datenbanken Beispiele, Gaadt 23 Westerland,